I have a fasta file. From that file, I need to get the only sequences containing GTACAGTAGG
and CAACGGTTTTGCC
at the end and/or start of the sequence and put them in a new fasta file. So here's an example:
>m121012_054644_42133_c100390582550000001523038311021245_s1_p0/7/2516_3269
***GTACAGTAGG***GTACACACAGAACGCGACAAGGCCAGGCGCTGGAGGAACTCCAGCAGCTAGATGCAAGCGACTA
TCAGAGCGTTGGGTCCAGAACGAAGAACAGTCACTCAAGACTGCTTT***CAACGGTTTTGCC***
>m121012_054644_42133_c100390582550000001523038311021245_s1_p0/7/3312_3597
CGCGGCATCGAATTAATACGACTCACTATAGGTTTTTTTATTGGTATTTTCAGTTAGATTCTTTCTTCTTAGAGGGTACA
GAGAAAGGGAGAAAATAGCTACAGACATGGGAGTGAAAGGTAGGAAGAAGAGCGAAGCAGACATTATTCA
>m121012_054644_42133_c100390582550000001523038311021245_s1_p0/7/3708_4657
***CAACGGTTTTGCC***ACAAGATCAGGAACATAAGTCACCAGACTCAATTCATCCCCATAAGACCTCGGACCTCTCA
ATCCTCGAATTAGGATGTTCTCCCCATGGCGTACGGTCTATCAGTATATAAACCTGACATACTATAAAAAAGTATACCAT
TCTTATCATGTACAGTAGG***GTACAGTAGG***
>m121012_054644_42133_c100390582550000001523038311021245_s1_p0/7/4704_5021
***GTACAGTAGG***GTGGGAGAGATGGCAGAAAGGCAGAAAGGAGAAAGATTCAGGATAACTCTCCTGGAGGGGCGAG
GTGCCATTCCCTGTGGTCACTTATTCTAAAGGCCCCAACCCTTCAAC***CAACGGTTTTGCC***
>m121012_054644_42133_c100390582550000001523038311021245_s1_p0/8/4223_4358
AAATATTGGGTCAAAGAACCGTTACTTTTCTTATATATGCGGCGCGAGGTTTTATATACTGATAAGAACCTACGCCATGG
GACATCTAATTCAGAGGGAAGAAGGTCCATGTCTGTTTGGATGAAATTGAGTCTG
(*
added for highlighting)
I need some way to get the only sequences containing GTACAGTAGG and CAACGGTTTTGCC at the end and/or start of the sequences and get them out in a new fasta file. I'm very new to this. I'm not even sure if it can be done. Thanks in advance for any help you can give.
Here's one way to do it in Biopython:
We're using generator expression (the line that begins with 'filtered') so the filtering is done as the program's reading through the source file. This has the advantage of being memory-efficient.
We're also creating a new function to check the starts and ends of the sequence to make the program more readable. In theory, you could do the check inside the generator expression, but that would make the line unecessarily long.
Hope that helps :).
Python has a method built in to strings called startswith(), and also one called endswith(). So you could test to see if it starts with one and ends with the other, and vice versa.
While checking that a string has a certain sequence at the end and/or beginning is indeed a very simple task for Python (refer to
str.startswith
andstr.endswith
), this does not address the problem of extracting the sequence from the FASTA file as a string. There are certain issues here, e.g. the sequences must be separated from their annotations and also they can span multiple lines. So applying the string methods directly to the lines of the file will not produce the desired result.This is why you need an actual parser for the FASTA format. The parser will process a FASTA file and give you annotations and sequences as Python strings. BioPython indeed provides one, and you can do something like this:
I can also recommend using
pyteomics
(a Python-based proteomics microframework I'm involved in developing) for manipulating FASTA files:Probably not the best way, depending on size of your sequences, but this will get the job done.