CSS: how can I force a long string (without any bl

Question

I have a long string (a DNA sequence). It does not contain any whitespace character. e.g.:

ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA

what would be the css selector to force this text to be wrapped in an html:textarea or in a xul:textbox

Answer 1

Here are some very useful answers:

How to prevent long words from breaking my div?

to save you time, this can be solved with css:

white-space: -moz-pre-wrap; /* Mozilla */
white-space: -hp-pre-wrap; /* HP printers */
white-space: -o-pre-wrap; /* Opera 7 */
white-space: -pre-wrap; /* Opera 4-6 */
white-space: pre-wrap; /* CSS 2.1 */
white-space: pre-line; /* CSS 3 (and 2.1 as well, actually) */
word-wrap: break-word; /* IE */
word-break: break-all;

Answer 2

<textarea style="width:100px; word-wrap:break-word;">
  place your text here
</textarea>

Answer 3

just setting width and adding float worked for me :-)

width:100%;
float:left;

Answer 4

In a case where the table isnt of fixed size, below line worked for me:

style="width:110px; word-break: break-all;"

Answer 5

Place zero-width spaces at the points where you want to allow breaks. The zero-width space is ​ in HTML. For example:

ACTGATCG​AGCTGAAG​CGCAGTGC​GATGCTTC​GATGATGC

Answer 6

Use <wbr>tag:

ACTGATCG<wbr>AGCTGAAG<wbr>CGCAGTGC<wbr>GATGCTTC<wbr>GATGATGC

I think this is better than using zero-width space ​ which could cause problems when you copy the text.